EST details — SGN-E288268

Search information 
Request: 288268Match: SGN-E288268
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C75945Clone name: cLES-16-D5
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C184406 is on microarray TOM1: SGN-S1-1-5.4.16.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184406 [TUS-44-L4] Trace: SGN-T199999 EST: SGN-E398673 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E288268Length: 453 bp (944 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E288268 [] (trimmed) TAGTCTACTTGCACCATGATTGCTACCCTTGCATTGTCCACAGAGATGTCAAAGCTAACAACGTGCTTCTTGACAAGGACGGAAGAGCAAAAGTC
ACCGATTTTGGCCTTGCCAGGGTCATGATTTCTGAACATACTCATGTTAGCACAATGGTGGCAGGGACTATTGGTTATGTTGCACCAGAATATGG
GCAGATAATGCAGGCCACTACAAAAGGAGATGTCTACAGCTATGGGGTGCTAGCAATGGAGCTAGCAACTGGGAGGCATGCTATAGATGGGGGCG
AAGAATGTCTAGTTGAATGGGCGACAAGGGTCATGGGAGACGGAAGGAAAGGGTTCACCAGAGCCATTATACCAGATGCTCTATTGGTACCTGGC
CTAGTAGAGGGAGCAGAGGAAATGTATGAGTTGCTTANGATTGGGATAAGGTGCACAGCTGAGACGCCTCATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E288268] SGN-U600240 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T100994 [Download] [View] Facility Assigned ID: TPSCK15TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0297 Quality Trim Threshold: 12.5