EST details — SGN-E289059

Search information 
Request: 289059Match: SGN-E289059
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C76594Clone name: cLES-18-I15
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179176 is on microarray TOM1: SGN-S1-1-3.2.2.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179176 [TUS-31-B6] Trace: SGN-T185614 EST: SGN-E373476 Direction: 3' Facility: INRA
Clone: SGN-C179176 [TUS-31-B6] Trace: SGN-T185615 EST: SGN-E373477 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E289059Length: 440 bp (867 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E289059 [] (trimmed) TCTTGCTGGCTAAGCCTAGTGTCTCTGGAGCAAAACGAAAAGCTGTTACACCACCAGTGGATGTTGCCAGCCAGCCTCCGTTTTTCAGTGTTCCA
AACAAAAATGGGAAAGAGGACTGGAGTTGTGCACTTTGCCAGGTAAGTGCGACTTGTGAGCGTGGACTGAATGATCACCTCCAAGGAAAGAAACA
CAAGTCCAAGGAAGCTGCTTTGCGAGAACAGAGGTTCGGTAAGAACTACAGCATCGGTCTTTTTCCAAAGAAACCTAAGATTAACAACCTTTCAG
AAGCCGATGGCAATGTTAACATGGAGCGAATGGTAAAACCACAGGGTGAATTGTTGGTTCACAACAAATCAAGGGAAAGATGATCTCTATTAATT
TTGGAGAAAGAAAGTGCCGAGGACACCATCACCCTAACTCTGCATCACAATGCTGATGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E289059] SGN-U564936 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T101501 [Download] [View] Facility Assigned ID: TPSCQ56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0297 Quality Trim Threshold: 14.5