Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E289210

Search information 
Request: 289210Match: SGN-E289210
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C76464Clone name: cLES-18-C1
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C184424 is on microarray TOM1: SGN-S1-1-3.4.16.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184424 [TUS-44-L22] Trace: SGN-T198434 EST: SGN-E397108 Direction: 3' Facility: INRA
Clone: SGN-C184424 [TUS-44-L22] Trace: SGN-T198435 EST: SGN-E397109 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E289210Length: 469 bp (856 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E289210 [] (trimmed) TGGAAATTCACCTTACATCAACTGTTTACCGTCACTTCACCACCACACACTTGGTTCAAGAGACAAGTTCTTGATCTTATCATCCGATGGGCTCT
ACCAATACTTCACCAACGAAGAAGCAGTCTCCGAAGTAGAGACCTTTTTGTCTATATTCCCCGAGGGAGATCCTGCACAACATCTTGTCGAAGAA
GTCTTATTCAGAGCTGCTAAGAAAGCTGGCTTGAACTTTCACGAGTTGCTTGATATACCTCAAGGTGATCGTAGGAAGTTCCATGATGATGATTC
AATCATCATTTTATCCTTCGAAGGAAGGATATGGAAATCATCTATGTAAATCTCACGTCTATCGAGGAATTTTGGAAGTATACCCTCAAGACCAC
ATCATCAGTACATACAAGAATTCGAGCTTGTTATGCTTTGTTAGCCCCTACTCTACCCCGAATTTAGCACCTGTTGCGGATAGTATACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E289210] SGN-U588286 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T101652 [Download] [View] Facility Assigned ID: TPSCQ13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0135 Quality Trim Threshold: 12.5