EST details — SGN-E289758

Search information 
Request: 289758Match: SGN-E289758
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C87443Clone name: cLET-4-J6
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C181957 is on microarray TOM1: SGN-S1-1-6.2.10.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181957 [TUS-38-F3] Trace: SGN-T194447 EST: SGN-E393121 Direction: 5' Facility: INRA
Clone: SGN-C181957 [TUS-38-F3] Trace: SGN-T194694 EST: SGN-E393368 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E289758Length: 388 bp (1013 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E289758 [] (trimmed) CGCCAGAGAAGAAATTAATCACACTGGGTTGGAGAAGCGCCAAAAAGGTCTTTCAGCTGTGTTTCTGGGCATATTGCCATATCTCAGATCAAAAT
TGCATTCAATCTACAATAAATAAAGAGAGGCTGCTCTTCAAGCTACTTTATGGGGCACTGAGGATGAGAGATTTGGTGACACTGACTATTTTGAT
GGAAATGGAAACTCCATAGTTTCAACAAGCAGTTCAGATACAGAAGAATCAGTTTGAGATCGTTTGAGAAAGAAAATTCGTAAGATCGTAGCTGG
TTGCTACCCATGGATACATGCTGGAAATGAAGGTTTATCATTTGCTTACCAGCTACTGCATTTGCTGGATGCTACTGGATTTTACTCTCTAGGAC
TCCATGCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E289758] SGN-U575082 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T103429 [Download] [View] Facility Assigned ID: TMEAP51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0300 Quality Trim Threshold: 14.5