EST details — SGN-E289867

Search information 
Request: 289867Match: SGN-E289867
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C88823Clone name: cLET-9-L22
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184849 is on microarray TOM1: SGN-S1-1-2.2.14.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184849 [TUS-45-N15] Trace: SGN-T200051 EST: SGN-E398725 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E289867Length: 323 bp (731 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E289867 [] (trimmed) TTGTAATACAACCAACCACCAAAGTTCATTACAATACTCGACAACATATAAGTACTCCAACAAACAAAAATACAAAATAAAAGAGACAACATATT
ATAAAATGATGGATTAAACTCGATCGATCGATAGATATCCGTCTTATTTTTCCCCAATTATGCCTTGGAAAATTGAACTTTCATCAACCTTACTG
AACCTTCGAGCAGTCAGTAAAAGGGCTGATCTTGTAAGGAATGCTTACGCCACAAGCACTAGGTATACCAGCGGCTTTGCCTAGATTAAGGCCTT
TAATAGCATTAGCAGCTGATTTGAGGCAAGTGCATGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E289867] SGN-U579687 Tomato 200607 Build 2 127 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104682 [Download] [View] Facility Assigned ID: TMEBJ71TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0049 Quality Trim Threshold: 14.5