EST details — SGN-E290327

Search information 
Request: 290327Match: SGN-E290327
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77289Clone name: cLES-20-I1
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179300 is on microarray TOM1: SGN-S1-1-7.3.2.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179300 [TUS-31-G10] Trace: SGN-T185207 EST: SGN-E373765 Direction: 3' Facility: INRA
Clone: SGN-C179300 [TUS-31-G10] Trace: SGN-T185208 EST: SGN-E373766 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290327Length: 585 bp (836 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290327 [] (trimmed) CTTCGTTATATTCAAGCTCTTAGGTGAAGATCGGAAAAAATGGTCGCACCATTAGTAGCAGGAATGGCTATAGCCGCTGCTGCATATGCTTCAAG
GTATGGAATCCAGGCATGGCAAGCATTCAAGGCCAGACCTCCCACTGTGAGAATGCGCAAGTTTTATGAAGGAGGATTTCAGCCTAAAATGAACA
GAAGGGAAGCAGCTCTGATTCTTGGAGTCAGGGAAAACACTGAAGCAAATAAAGTGAGGGAAGCACATAGGAAGGTGATGGTAGCTAACCATCCA
GATGCACGAGGTAGTCACTACCTTGCTTCTAAAATAAACGAGGCGAAAGACACTTTGCTTGGACAGACGAAGAACAATGGATCCGCGTTCTAGGC
TACACGAAATTTTTGCTGGTACTTAGACATACCCAAATCCAAGAGTCTTTAGTCAAAAAATTAGACACTAGAACATTGAGAATACATCATAAGAT
GTACAAGTTACAACTAGTTTGTTTTAATTCTAAGCAAGCTTGAGAAGTCGATTATATGAATTCTCACTATTCATGTGGCATTTTGGGTAGGTGAA
AGGCTCTGCTTACAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290327] SGN-U572341 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102006 [Download] [View] Facility Assigned ID: TPSCY49TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0083 Quality Trim Threshold: 12.5