EST details — SGN-E290555

Search information 
Request: 290555Match: SGN-E290555
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C77422Clone name: cLES-20-O12
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179355 is on microarray TOM1: SGN-S1-1-8.1.2.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179355 [TUS-31-I17] Trace: SGN-T185048 EST: SGN-E372591 Direction: 3' Facility: INRA
Clone: SGN-C179355 [TUS-31-I17] Trace: SGN-T185049 EST: SGN-E372592 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290555Length: 336 bp (516 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290555 [] (trimmed) GGAACAACAGTTGGCCTGTTAATAGATTTATTTAGCCGATGTTGTTCAATTACGCCTTGCTTCTGCAAACTAGAATCATGATCATTGGTTGGAAT
AACCTCAGACCAATTTTCCAACTTATGGCTGGCTTGATCACTCTGTAGCAGCTTGGGAGAATCCAAAGACTCCAAGCTTTTAAGAACTTGCCCGC
GAAGCATGTTTGGTGACAATTTCTTGGGTGTCTTATCACTCCCTGCAGTTAGTCTTGATTCTGATGACTTCTCCTTTGGAGTCAGATTGTCAAGA
TGCTCCAATATCTTTGCAGCTGTCTCACTGGGATCGGAAGAGATGTGAGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290555] SGN-U595008 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102234 [Download] [View] Facility Assigned ID: TPSCZ90THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0184 Quality Trim Threshold: 14.5