EST details — SGN-E290779

Search information 
Request: 290779Match: SGN-E290779
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C79820Clone name: cLET-10-E13
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184719 is on microarray TOM1: SGN-S1-1-4.1.14.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184719 [TUS-45-I5] Trace: SGN-T198487 EST: SGN-E397161 Direction: 5' Facility: INRA
Clone: SGN-C184719 [TUS-45-I5] Trace: SGN-T198571 EST: SGN-E397245 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290779Length: 535 bp (871 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290779 [] (trimmed) AATTTCCTATAAAGAGAGTAAAGCAATACCTAAAAACGAAAGATACATCCTTTTATTTTCATTGATCTTCAAGTCATAAAAAGAAGAAAAAGATC
ATTTTGTTCCTAGATATCGATCGATCGTGTAGGTAGAATGGGAAGGCCACCTTGCTGCGATAAAATAGGGGTGAAAAAAGGACCATGGACACCAG
AAGAAGATATCATCTTGGTTTCATACATTCAACAACATGGTCCTGGTAACTGGAGAGCTGTTCCCAGTAATACTGGTTTGCTTAGATGCAGCAAA
AGCTGTAGGCTCAGATGGACTAATTATCTCCGGCCCGGAATTAAACGTGGAAACTTCACTGAACATGAAGAAAAAATGATTATCCATCTTCAAGC
TCTTCTAGGCAACAGATGGGCTGCGATTGCTTCGTATCTCCCACAAAGGACAGATAACGATATAAAAAATTACTGGAATACTCATCTGAGGAAAA
AGCTGAAGAAACTTCAAGGGAATGATGAGAATAGTACTCAAGAAGGAGAAAGCTCATCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290779] SGN-U570718 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104948 [Download] [View] Facility Assigned ID: TMEBK31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0050 Quality Trim Threshold: 14.5