EST details — SGN-E291163

Search information 
Request: 291163Match: SGN-E291163
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C88511Clone name: cLET-8-H6
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C182009 is on microarray TOM1: SGN-S1-1-2.4.10.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182009 [TUS-38-H7] Trace: SGN-T194455 EST: SGN-E393129 Direction: 5' Facility: INRA
Clone: SGN-C182009 [TUS-38-H7] Trace: SGN-T194704 EST: SGN-E393378 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291163Length: 531 bp (830 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E291163 [] (trimmed) CTCAGCCACTGAGTGCTACTGCTGCAGAGCCTCCATCACCTGTTAATGTGCAGCAGCAAAAGCCTAGTAAATCTGCGCGCCTGTCAGCCTCTGCG
GATTCCACTGATTGGATTGCCTCCTCCTTAACAAGGAGATTTGGCCTTGGTGCTGGACTTGCTTGGGCTGGTTTCCTTGCTTTTGGTGTTGTTTC
TGAGCAAATCAAAACTCGTCTTGAAGTGTCTCAACAAGAAACAAACACAAGGGTTGTTGAGAAAGAAGAAGAAGTGGTCTTGCCCAATGGGATAA
GGTATTATGAACTGAAAATTGGTGGCGGTGCAACAGCAAGGCCAGGGGACTTAGTTGTGATAGATGTGAAGGGAAGCATACAAGGCAGTGGAGAA
GTTTTTGTGGATACATTTGGTGGTGATGGAATGAAGAAGAGGCCATTGGCATTAGTAATGGGATCAAGGCCTTATAGTAAAGGAATTTGTGAAGG
TATAGAAACAGTACTAAAAAGTATGAAGGCAGGTGGAAAAAGAAGAGTGATAATTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291163] SGN-U577137 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T104559 [Download] [View] Facility Assigned ID: TMEBF39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0088 Quality Trim Threshold: 14.5