EST details — SGN-E291211

Search information 
Request: 291211Match: SGN-E291211
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C84709Clone name: cLET-2-A20
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190615 [TUS-60-N21] Trace: SGN-T341414 EST: SGN-E540539 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C190615 [TUS-60-N21] Trace: SGN-T349276 EST: SGN-E548401 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291211Length: 146 bp (954 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E291211 [] (trimmed) CGGTTACCTGAACTTCAATCTCATTTTTGAGTTGAATTTTTATCTCATTAGTTATGATTCGATTCTCCACCTTTGTAATCCTCTTTCCAATTACC
CTTTGTAGCTACCCTGTTTTATTTTATTTTTAAAAAGTTAATATAATGTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291211] SGN-U599903 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102752 [Download] [View] Facility Assigned ID: TMEAF10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.879 Expected Error Rate: 0.0014 Quality Trim Threshold: 12.5