EST details — SGN-E291259

Search information 
Request: 291259Match: SGN-E291259
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C84916Clone name: cLET-2-L10
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184537 is on microarray TOM1: SGN-S1-1-2.1.14.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184537 [TUS-45-A15] Trace: SGN-T1829 EST: SGN-E378227 Direction: 5' Facility: Giov. Lab
Clone: SGN-C184537 [TUS-45-A15] Trace: SGN-T198453 EST: SGN-E397127 Direction: 5' Facility: INRA
Clone: SGN-C184537 [TUS-45-A15] Trace: SGN-T198544 EST: SGN-E397218 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291259Length: 392 bp (816 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E291259 [] (trimmed) GCGCCATAAAAAGAGTATTCATGAAAATTCCAGTATTGTGACTTCGCACGCAACATCTACTCAGCCAGCCTCCAGTCGCCATTGTTATGCCCGGT
ATGGAAGCTGAGAACTCAAACGCCTCCCGAGCTGAAGAACTCAAGCAACTCGCAAATGAAGCATTCAAAGGGCATAAGTATTCGCAAGCTATTGA
TCTGTACACACAAGCGATTGAGTTGAACGGTGAGAATGCGGTGTACTATGCTAACCGTGCGTTTGCTCACTCCAAATTGGAGGAATATGGAAGCG
CAATACAGGATGGAACTAGAGCTATTGAAATTGACCCTAGATATTCAAAGGGTTATTATAGGAGAGGAGCTGCATATTTGGCAATGGGGAAGTTC
AAAGATGCACTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291259] SGN-U583112 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102800 [Download] [View] Facility Assigned ID: TMEAH65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0109 Quality Trim Threshold: 14.5