EST details — SGN-E291333

Search information 
Request: 291333Match: SGN-E291333
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C84898Clone name: cLET-2-K14
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190631 [TUS-60-O13] Trace: SGN-T341439 EST: SGN-E540564 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190631 [TUS-60-O13] Trace: SGN-T349281 EST: SGN-E548406 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291333Length: 533 bp (928 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E291333 [] (trimmed) TGCAGGGTTCTCTCTCGAAGGATGGAAAAGACACCAAGGATGCCAAAGCTGGAAAGGACGGAAAAGACACCAAGAATGCTACAGTATCTTTAGCC
TTCTCTATAATTTCATCAGAAAAATGTCAGGCAGAGGTAAGGGAGGCAAAGGATTGGGCAAAGGAGGAGCCAAGAGGCACAGGAAAGTGTTGAGA
GACAACATTCAAGGAATTACAAAGCCAGCTATTCGAAGACTCGCTCGTAGAGGTGGTGTGAAGCGTATTTCTGGGTTGATTTACGAAGAGACTCG
TGGTGTTCTGAAGATCTTTTTGGAAAATGTAATTCGTGATTCCGTGACATACACAGAGCACGCTAGGAGAAAGACGGTTACTGCTATGGATGTTG
TTTATGCGCTTAAGAGGCAAGGAAGGACCCTTTACGGATTTGGGGGTTAGGGTTTGCCTTAGGATTGTTAATTTTATTCTCATCTTTGATGGTGT
AATTCTCTGTTATACTAATTCAAAGAATAGAGTTTTTCTTAAANAACAAAATAATAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291333] SGN-U592662 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102874 [Download] [View] Facility Assigned ID: TMEAF67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0115 Quality Trim Threshold: 12.5