EST details — SGN-E291456

Search information 
Request: 291456Match: SGN-E291456
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C84954Clone name: cLET-2-M6
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190634 [TUS-60-O16] Trace: SGN-T341444 EST: SGN-E540569 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C190634 [TUS-60-O16] Trace: SGN-T341447 EST: SGN-E540572 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E291456Length: 324 bp (940 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E291456 [] (trimmed) GTCTACAACAAAGAAAAAACAATGGAAGGCATTGAGCACAGAACATTGAACGTTAATGGCATCAACATGCATGTAGCTGAAAAAGGCAAAGGCCC
CGTAGTTCTCTTCCTCCACGGCTTCCCCGAGCTATGGTACACGTGGCGCCACCAGATTGTAGCCTTGGCTGACCAAGGCTACCGCGCGGTGGCGC
CCTATTTACGTGGCTACGGGGACACGGACGCACCTAAGGAAGACACGAGCTATACTCATTTTCACGTAGCGAGAGACTTGGATGCGCTTATTGAC
CCGTTAGGAGTTGAGAGTGTGTTTGTAGTGGCACATGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E291456] SGN-U595626 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102997 [Download] [View] Facility Assigned ID: TMEAF75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0198 Quality Trim Threshold: 14.5