Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E292089

Search information 
Request: 292089Match: SGN-E292089
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82263Clone name: cLET-1-G3
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179451 is on microarray TOM1: SGN-S1-1-8.1.2.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82263 [cLET-1-G3] Trace: SGN-T102362 EST: SGN-E292088 Direction: 5' Facility: TIGR
Clone: SGN-C179451 [TUS-31-M17] Trace: SGN-T185069 EST: SGN-E372612 Direction: 3' Facility: INRA
Clone: SGN-C179451 [TUS-31-M17] Trace: SGN-T185070 EST: SGN-E372613 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292089Length: 501 bp (557 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E292089 [] (trimmed) AGTATTAAAACAAATGCCATTAATTCAAAAGATGAAGGGAACACAACAAAGTAAAATTACTACAGTTTCTCCAGAGAAAAACTTTAAGGAGGATT
CAAACAAGCTTCCCCTAAATACATAGGGTCAGTTATACATTACATAATTAAAAATTGGCATTTTAGTATCCTTCGGGCTTGTAAGCGATGAAACT
GATGCACTGCACTTGACGAACATTGTCGAATCCGATGATACGGACCCATGCCTGAGGGTAAGCCTTCTTTGCCTCCTGCACCTCAGCCAAGACCT
GGGTTGCATCAGTGCACCCAAACTTTTTTTTTACCTTCAAATCTCAAAATCTTCTATATCAAGTCAAAACAAGACAAATAAATTAAAACGCAAAG
AACTTTTATTTACATCAAAACGAACATAGTCACTCCCGAATATGTATAAACATACAAGTAATGTTACAATAAAAGAAATACAAATACATATCTAA
TGCAGGAACAAACAGGAAAAAAACCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292089] SGN-U580380 Tomato 200607 Build 2 55 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102363 [Download] [View] Facility Assigned ID: TMEAA38TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0002 Quality Trim Threshold: 14.5