EST details — SGN-E292150

Search information 
Request: 292150Match: SGN-E292150
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82127Clone name: cLET-1-A10
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179365 is on microarray TOM1: SGN-S1-1-6.2.2.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179365 [TUS-31-J3] Trace: SGN-T185486 EST: SGN-E373348 Direction: 3' Facility: INRA
Clone: SGN-C179365 [TUS-31-J3] Trace: SGN-T185487 EST: SGN-E373349 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292150Length: 217 bp (943 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292150 [] (trimmed) AAGATCATCTTCCCCAATGTTGGTAACCCCCATGCCCTCGTGCAGAAACCACTGACATTTCCACGCCAGGTCATTGCTCTCTGTCAAGCTCCATT
TTTACTGGATGATCCGAATGTGGGACTCATATTCCCTGCTGATGCAATTGCATGAGCCAAACAGCTTCTTGGGATGACTCCTGGAGGTCTACGTG
CTTATAGGGACTCCCGAGGCATTCCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292150] SGN-U580147 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102424 [Download] [View] Facility Assigned ID: TMEAB05TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0355 Quality Trim Threshold: 14.5