EST details — SGN-E292776

Search information 
Request: 292776Match: SGN-E292776
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80300Clone name: cLET-11-N12
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179724 is on microarray TOM1: SGN-S1-1-7.1.1.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179724 [TUS-32-I2] Trace: SGN-T185990 EST: SGN-E372495 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292776Length: 413 bp (911 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292776 [] (trimmed) CATACTCTTGATCATGATATTGATATTAACGAAGACACCTTTGAGTTCAAATTCGATTACGATTCGTCGATAAATATTATCGGAGACGATGAAGT
AGTGACGAAGGATGAAAATAAAAAGAAGATTTTATTAAATCTTGACTATGAAGGTGTATTAAAAGCATGGCCTTTCACCATTAGTCCAAGGACAC
CTTTGGTCAGCCATGGTGGAAGGATCACCATTGGGGTTACAAATGCTGCAAACAGACAATCAGAAACAGCTACTGTACAGGTGCTGCTGGAATTG
AAGCAGCTGAGGCTTCTACTGATCTTATGAAGGCCAATATTGCTCGCAAGGAGTCTGCTGAAGATACACATGCGCCGGTTGAGGAGAAGAGGCTC
ACTACTTGGGGAACTGAAGTTCCTGACGATTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292776] SGN-U573005 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105239 [Download] [View] Facility Assigned ID: TMEBR78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0009 Quality Trim Threshold: 14.5