EST details — SGN-E292784

Search information 
Request: 292784Match: SGN-E292784
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80351Clone name: cLET-11-P18
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179742 is on microarray TOM1: SGN-S1-1-5.1.1.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179742 [TUS-32-I20] Trace: SGN-T185999 EST: SGN-E372504 Direction: 3' Facility: INRA
Clone: SGN-C179742 [TUS-32-I20] Trace: SGN-T186000 EST: SGN-E372505 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292784Length: 546 bp (896 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292784 [] (trimmed) AAGACACAGTTAACCAAAGTTGAGAGATGGCAGATATTAAGTTGCTTGGTCTATGGTATAGCCCTTTTAGTAAAAGAGTTGAATGGGCTCTTAAG
ACTAAGGGTGTGGAATATGAATATATAGAAGATGATCTACAAAATAAGAGCCTTTTACTTCTTCAATCCAATCCAATTCACAAGAAAGTCCCTGT
GCTCATTCACAATGGGAAGCCAATTTGTGAGTCAAGTGTGATTCTCGAATACATTGACGAGACATTTGAAGGCCCTTCCATCTTACCTAAAGACC
CTTATGATCGAGCTTTAGCTCGTTTCTGGGCTAAATTCTTCGAAGATAAGTGGCCATCAATGATGAAAAGTCTATTTTTCAAAGGAGAGGAGCAA
GAGAAAGGTAAAGAGGAAGTTAATGAGATGTTGAAAATTCTTGATAATGAGCTCAAGGACAAAAAGTTTTTTGTTGGTAACAACTTTGGATTTGT
TGATGTTGTTGCAAATGCTGTAGCCCTTTGGTTTGGAGTTCTTGAAGAAGTAATTGGAGTTGTTTCGGTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292784] SGN-U580668 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105247 [Download] [View] Facility Assigned ID: TMEBR93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0025 Quality Trim Threshold: 14.5