Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E293028

Search information 
Request: 293028Match: SGN-E293028
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80372Clone name: cLET-12-A19
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C182111 is on microarray TOM1: SGN-S1-1-4.4.10.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182111 [TUS-38-L13] Trace: SGN-T194722 EST: SGN-E393396 Direction: 3' Facility: INRA
Clone: SGN-C182111 [TUS-38-L13] Trace: SGN-T199330 EST: SGN-E398004 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293028Length: 411 bp (874 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293028 [] (trimmed) GGCATTCCCCTTTCTTTGCTGGTTATAGGCCACAGTTTTACATGAGAACAACTGATGTGACCGGAAAGGTTACTGCTATTATGACTGACAAGGGA
GAAGAATCTAAGATGGTCATGCCTGGTGATCGCGTAAACATGGTGGTCGAGCTCATTATGCCAGTGGCTTGTGAGCAGGGTATGAGGTTCGCTAT
TAGGGAAGGAGGAAAGACTGTCGGAGCTGGTGTTATTCAGAAAATCTTAGAATGATGAACTTGCAGCTGAGCATCCCTTTTCACATATGGTCGGA
TTTTTCCATTGAAGTTTATTAATCCATTGTCATATATGCGACTTTTTGGTTACTTTTGTTATGTCTTAGAATCTTACTTTAGTTGAAGTATCCTG
TTTTATCGCCCAATTCTACTGAACTTTTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293028] SGN-U577523 Tomato 200607 Build 2 62 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105491 [Download] [View] Facility Assigned ID: TMEBS10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0024 Quality Trim Threshold: 12.5