EST details — SGN-E293030

Search information 
Request: 293030Match: SGN-E293030
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80402Clone name: cLET-12-C17
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C190833 [TUS-61-G23] Trace: SGN-T341786 EST: SGN-E540911 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293030Length: 487 bp (861 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293030 [] (trimmed) GAAGTTGAAGTATTTGCACTTAGAGCTGAAAAGCTCAAGGTTGTCGCAAACCAGTTCAGACGCCTCCATAGTAAAAAACTACAACATGCATTTCG
ATACTACTCACACCAATGGAGGACGTGGGGAGCTTGCTATATACAAGCTGCATGGAGACGCCATAGGAGGAAAATACTAGGGGAAGAATTATCAA
GAGAAGAGAGCTTGTACTACAGGGGAGGGATGGACCAAGATGACAATTATGGTCGTGAATATCCAGAAGCTGGTGGTAATGCTTCGGATCAGGCA
ACAGAAAGCAGTACTCAGCAACTTGGAGTATTGGCATCAAGATTTGCTGCTAATACCAGAAGAGGCAAGACGGGGGGACGTGTGGACTCTGGTGA
ATCCAGCTTACGTATGCCTAAACTTTTTAAGCCTGACGAGCCTGATTTTTCTCATGATCCTAGTAGTTGAATCGCGAGTTCTGGTTTTTGGGTTG
GAGTTGGTAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293030] SGN-U582909 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105493 [Download] [View] Facility Assigned ID: TMEBS21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0111 Quality Trim Threshold: 12.5