EST details — SGN-E294001

Search information 
Request: 294001Match: SGN-E294001
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C80720Clone name: cLET-13-D18
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179766 is on microarray TOM1: SGN-S1-1-5.2.1.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179766 [TUS-32-J20] Trace: SGN-T186328 EST: SGN-E372847 Direction: 3' Facility: INRA
Clone: SGN-C179766 [TUS-32-J20] Trace: SGN-T186329 EST: SGN-E372848 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E294001Length: 498 bp (900 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E294001 [] (trimmed) TTGCAAAGACTCAACCAAGTATGTAGGTTTCATTTGCAACAAGAACAAAGTTGTTGCTGTCAATTTCAATGGTAGAAACTTCAAGGGAAATCCTC
TGTCTCTCAAAGATTTCATTAATGGAATCCCAACTCTCGAAATCTTCCATTCCAACTCCAACAACTTCACTGGAGAAATACCCAATAATATATCG
ACCCAGAGTATTCCTAATCTTTTCGAACTTGATTTGAGCAACAACAAATATGTTGGTTTATTTCCAAGAGCTGTTCTTGGTGCCACCAGGTTAAC
TTATTTGGATCTCAGATTCAACCAAATCGAAGGTCCAGTCGACCCTCAAGTATTCACACTCGACCTTGATATTCTTTTTCTCAACAACAATCAAT
TTTCCGGGAAAATCCCAGAAAATTTTGGCCGTACTGCTGCCCTGTATCTTACATTAGCCAACAATAAATTCATTGGTGAAATCCCCAAAAGCATT
GTGTATGCGAAGGGAAATCTCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E294001] SGN-U575978 Tomato 200607 Build 2 35 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105844 [Download] [View] Facility Assigned ID: TMEBZ21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0038 Quality Trim Threshold: 14.5