EST details — SGN-E295193

Search information 
Request: 295193Match: SGN-E295193
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82713Clone name: cLET-20-P9
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C181922 is on microarray TOM1: SGN-S1-1-1.4.10.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181922 [TUS-38-D16] Trace: SGN-T187763 EST: SGN-E374493 Direction: 3' Facility: INRA
Clone: SGN-C181922 [TUS-38-D16] Trace: SGN-T187764 EST: SGN-E374494 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E295193Length: 472 bp (976 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E295193 [] (trimmed) CTCCCCTCTATTTTGTAGGGTTATTTGGATCTCTCTCTTATCCCACTTAGGCACTTCTAGGGGTTCTTCCAACCAGCTATTGAAGATGGATTCTG
CAGGATTCTCTATGAAGCTGTGGCCCCCAAGTTCGAGTACCAGGCTAATGCTCGTGGAGAGAATGACCAAGAATCTTATTACTCCATCCATCCTA
TCCAGGAAATATGGTCTTTTGAGTAAAGAAGAAGCTGAAGAGGATGCCAAACAAATAGAAGCTCTGGCTTTTGATTCTGCCAATCAACATTTTGA
CAAGGAGCCTGATGGCGATGGAAGTTCTGCTGTGCAACTTTATGCTAAGGAATCTAGTAAGCTCATGTTAGAAGTTATTAAAAGAGGCCCTCAGA
CAAAGGAATCTGCAGAAGGTATTGTATCTGAGAAGGTTAAAGCATCTAATGAAACTACTATTTTTGATATATCCAAAGGTAGACGGGATTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E295193] SGN-U581946 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107607 [Download] [View] Facility Assigned ID: TMEDA89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0220 Quality Trim Threshold: 14.5