EST details — SGN-E296084

Search information 
Request: 296084Match: SGN-E296084
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C83426Clone name: cLET-24-K19
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C184674 is on microarray TOM1: SGN-S1-1-1.3.14.8
See unigene SGN-U570866 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C184674 [TUS-45-G8] Trace: SGN-T196550 EST: SGN-E395224 Direction: 5' Facility: INRA
Clone: SGN-C184674 [TUS-45-G8] Trace: SGN-T198618 EST: SGN-E397292 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E296084Length: 416 bp (699 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E296084 [] (trimmed) CTCCGGTGAACGGTTGGTATCGGCGGCCAGAGACGGCGATTATGTAGAAGCTAAGATGTTGCTTGATTGCAATCCATGTCTTTCAAAGTACTCGA
CTTTTGGTGGACTCAATTCACCTCTTCATTTTGCTGCCGCTAAAGGACACAACGAGATTGTTGCATTGTTGCTTGAGAATGGTGCTGATGTTAAT
TCTAGAAACTACTGTGGTCAGACGGCACTGATGCAGGCATGTCGATATGGTCACTGGGAAGTTGTTCAAACCCTTCTTCTCTTTAGATGCAATGT
TACCAGGGCAGATTATCTTAGTGGAAGAACAGCTCTCCATTTTGCAGCAGTGAATGGACATGTTAGATGCATAAGACTTGTGGTGACTGATTTCG
TTCCTAGTGCCCCTTTTGAGTCTATAAATGCTCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E296084] SGN-U570866 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T108601 [Download] [View] Facility Assigned ID: TMEDO70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0156 Quality Trim Threshold: 14.5