Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E296145

Search information 
Request: 296145Match: SGN-E296145
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C83296Clone name: cLET-24-B12
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191019 [TUS-61-O17] Trace: SGN-T342108 EST: SGN-E541233 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C191019 [TUS-61-O17] Trace: SGN-T349390 EST: SGN-E548515 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E296145Length: 552 bp (870 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E296145 [] (trimmed) AAATAAAAAAATTCATCCAATTTCCCTAACTCTTTATCTTACCATGAATGACACAGTGGACAAGCTGGTAATTTTCTTAGCAAAGAGAGATGGAA
TCGACAAGCTTGTCAAGACTTTTCAGTACGTTTCCAAGCTCGTAAATTGGCACGTCGAGACGACGTACCCTGACTTAGCCACTCGAGCCAAGCAA
TGGGAAGTGGCTTCTGGCCTCAGCCGAAAAGCCTTCCGTACAGGTCGATCCCTCACGGGATTCAACGCTCTCCGAAGAAGCCCCGGGACCACCCC
GGGTTTCAGACTGCTCGCAGTTCTCGCCAATTCAGGGGAAATGGTTTATTTCTTCTTCGACCATTTCCTCTGGCTGGCGAGAATTGGAGTAATCG
ATGGTAAATATGCGAAAAGGATGAGCTTCATTTCAGCATTTGGTGAGTCTGTTGGATACGTATTTTTCGTTATTTCAGATTTTATTCTCATCACA
AGGGGATTAAAAGCAGAGAGGAAGTTATTGATTGAAGAGAAGGATTCTAAAGAAGAAATTAAGAAAATTAGAATGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E296145] SGN-U565969 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T108662 [Download] [View] Facility Assigned ID: TMEDR06TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0131 Quality Trim Threshold: 14.5