EST details — SGN-E298289

Search information 
Request: 298289Match: SGN-E298289
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C89621Clone name: cLEW-18-I14
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E298289Length: 513 bp (943 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E298289 [] (trimmed) TGCACAGTAGAGTTTGGAGAAGTTGCCTCAGGAGAGGAAAAGAGGGGGTTACTAACCACACATTTGACAGCTCAAAACCACTTTACCAATCCAAA
CAAAAAATCATCACATTATCCCTCCCTTCTCTCCTTTCTCTATTACTCTCATTTTCCCCAAGTTTCAGACTTGGGAAGGCTGTGTAAACAAAAGG
GGTGTTTGGATTGTAAGGAATCATAATGTCAATGTCCTGCAAGGATGGTAAATCAATTGAAGATAACGGAAAGTATGTCCGTTATACACCTGAGC
AGGTTGAAGCTCTTGAAAGGCTATATCATGAGTGTCCAAAGCCCAGTTCAATGCGTCGCCAGCAGCTTATTCGTGAATGCCCGATTCTATCTCAT
ATAGAGCCTAGGCAAATCAAAGTTTGGTTTCAGAATAGAAGATGTAGGGAAAAACAGAGGAAAGAGTCATCAAGGCTTCAGGGTGTGAATAGGAA
GCTGTCAGCAATGAACAAGCTATTAATGGAAGAGAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E298289] SGN-U600563 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T113469 [Download] [View] Facility Assigned ID: TRDCR55TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0220 Quality Trim Threshold: 12.5