EST details — SGN-E29835

Search information 
Request: 29835Match: SGN-E29835
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C19898Clone name: cLED-28-H6
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181394 is on microarray TOM1: SGN-S1-1-1.2.14.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C19898 [cLED-28-H6] Trace: SGN-T56014 EST: SGN-E241536 Direction: 5' Facility: TIGR
Clone: SGN-C181394 [TUS-36-N16] Trace: SGN-T194213 EST: SGN-E392887 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E29835Length: 525 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E29835 [] (called/trimmed by facility)
CAGATCATTTCAATTTTGAGTCCCGAATATCCTAATTAATAAGAGGAAATTAAGAAAAAGAATAAAAAGAGCAATTGAACAAGGAATTTTTATTA
GACAGAAACTTTTATATTAATAAATATAATGTGTTTTTTAGATGGACAATTAGTCGGGGTGAGAATGAATGTAGTTGGATCCCCATTTATGAGTT
GGCTTATAATAGATCAGAGGTTGACTTAAAATATAAATGGAAACTAAGTATTTCCAAAGAGTAAATGTTTTCACTTTTAAGATGAGAGGAAACAC
TGGTTTGAAAATGAGTTATCATGAGAAAGTCTGAGTATCATCTCGTTTAAGAGAAATATTTTGAGTAATAATCTCAAACCACATAAAGAGTTATG
TTTTTAAAGGCTTAAGTCATCGATAGCCTCTTAAAGATATCCGCATGATTTATTTAGACACCTTATCTAAGGCTTATTCCAATGAACACCTTTTG
TAGTAAAAACTATTCTTATTGAACATTTTATGACAATCAACAAAACATAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T56014 [Download] [View] Facility Assigned ID: TOVEH39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence