EST details — SGN-E298468

Search information 
Request: 298468Match: SGN-E298468
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C85986Clone name: cLET-41-K13
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E298468Length: 237 bp (1015 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E298468 [] (trimmed) CTGATCAACAGCTACAACTGAACCGGTGCCCTTGTACCAGTAAGATTCAACAAAGTGAATTATGCTAATGTTTCAACCAACAACTATGCATTGGA
TGAAATTGAAGAAGTGTGAAATGAGAACGTATGCCCTCAATTGGAATAAGTATATTATTTGTAGAATGCAAGGCCCTTTGGTTTTTTCATGTTTA
TTCTCTAGTTATATACAGGCTTTGAATGTGAATGAGTGTCTTATTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E298468] SGN-U590193 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T110505 [Download] [View] Facility Assigned ID: TMEGE67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0047 Quality Trim Threshold: 12.5