EST details — SGN-E298726

Search information 
Request: 298726Match: SGN-E298726
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C86798Clone name: cLET-44-F14
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179865 is on microarray TOM1: SGN-S1-1-2.2.1.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179865 [TUS-32-N23] Trace: SGN-T186103 EST: SGN-E372950 Direction: 3' Facility: INRA
Clone: SGN-C179865 [TUS-32-N23] Trace: SGN-T186104 EST: SGN-E372951 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E298726Length: 470 bp (951 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E298726 [] (trimmed) GACTTTTTGGGTCGTAGGGAATAAAATAGCTCCGAGGAGTAGTCACAAGTACCCACGTAGCCCGACCCGGTCATACCATACGTCCTACTACTAAA
CACTCACAGACCCCGGCAGATATCCAACAGATGCACTTTCCTATGAATACCTTTCCTCCGGTTCTACTGGATCTATTCCTATTGGCGCACCCTTT
CAGTCGGGTAAGAGAGCCGGTTCCCGTCTCAATAAGTAAGGTACTTCGAGTCGTTCCTATACCCCTCGGTTCCTTATCTTAAGCTCCGAGGTACG
CGCCTCGAAGGGTCTCGGTGCACGAGAATGATATGCGTTACGGGCCGGGATCCCGGCCTACGGTGCCTAAGCCAAGAGCCGTTCTAATCCTAGAC
CGCTTATTAGATAAAAATACGACCTTCGGGATGGTAGGAGGGACCTCCCGGTGGAGGAGATCGATGGCGCAGCTAGTAATCCGTCGCGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E298726] SGN-U600307 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111362 [Download] [View] Facility Assigned ID: TMEGT31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0053 Quality Trim Threshold: 20.5