EST details — SGN-E298749

Search information 
Request: 298749Match: SGN-E298749
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C86983Clone name: cLET-44-P12
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179941 [TUS-33-B3] Trace: SGN-T186694 EST: SGN-E374080 Direction: 3' Facility: INRA
Clone: SGN-C179941 [TUS-33-B3] Trace: SGN-T186695 EST: SGN-E374081 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E298749Length: 429 bp (939 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E298749 [] (trimmed) CGGACTTTTTGGGTCGTAGGCTTACTCCTACTCGAGTTCCTCGGCTGAACCGATATTCGGTTTAGTTAAGACGACAAGTCCGAGTACTCCTACCT
AGTAGAAGTCAATGAGACGACCTAAAATTATTCGCTCTCTACCTCCGGAAGCTGGCCGGGCGACGACCTCGTAGCGGTATAAACAAGCAAACCAA
GAGCAGGTTAAGCCCACGTCGTACTAACCACGCACGGACACCCCTCTAGGAGAGCGGATTAGAGGCCCTAGTCGGAAAAGAGTACGAAAGCTTCC
TTCTTGGGCGCAGATAACGAAGACAGCAGTACTTAGTAAGCGGTAGGTGAGGACACTAGCGGTGACAGGAGCGACATTCTCCCTAGACTAATAAT
ATAAATTTATTTAGAACCGATACTACGGCTCGTAGGCGGCGCGAGCTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E298749] SGN-U599681 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111385 [Download] [View] Facility Assigned ID: TMEGT90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0069 Quality Trim Threshold: 20.5