EST details — SGN-E298893

Search information 
Request: 298893Match: SGN-E298893
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C86957Clone name: cLET-44-N24
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179935 [TUS-33-A21] Trace: SGN-T186369 EST: SGN-E373917 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E298893Length: 421 bp (923 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E298893 [] (trimmed) TCCCCATAAAACACCCATCCCACACCACACACATACAAGAAACAGCCCGACTCCGCAAACACAACGCGATCAATCGATAAAGCCGGCCTGAAAGA
GGGATCCGCCGAAACCGTACCACCCAACGAAAACGCCGATCTCTCCAACGAAACGCACACACCGATCCCCAACCCCCAGCGAAAACGCCGGTCCC
GTCCGCGTTAGAGACCCCCAGGTACTACAACCCCTCGACAACTCAATCCGAAACAAGAAACACATCAACCGTCACCGAAACACCCCCCCCCATAG
TTCCCGAAATCTCTACGGTATGAAAAGAAACCGACAGATCAGAAGCTATAGAATCCTCAAAGGAACCCGAACTTGATCCGACGCGTAAAGGAAAA
CCAAGCCGGTTAGAATCCACCGGCGCATTAGTATAACACGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E298893] SGN-U603115 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111529 [Download] [View] Facility Assigned ID: TMEGT84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.900 Expected Error Rate: 0.0069 Quality Trim Threshold: 20.5