EST details — SGN-E29905

Search information 
Request: 29905Match: SGN-E29905
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7544Clone name: cLEC-39-F22
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C7544 [cLEC-39-F22] Trace: SGN-T31860 EST: SGN-E208570 Direction: 5' Facility: TIGR
Clone: SGN-C168631 [TUS-3-J21] Trace: SGN-T736 EST: SGN-E379400 Direction: 5' Facility: Avesthagen
Clone: SGN-C168631 [TUS-3-J21] Trace: SGN-T1046 EST: SGN-E380065 Direction: 3' Facility: Avesthagen
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E29905Length: 581 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E29905 [] (called/trimmed by facility)
CAGATCTTCTACTTCTTTATCTCAAATTTCTCAGCTGACTGCATATTGAAAATCCTGAATCTCATCATTGTTGAAGACTTGCGAGTTTTCTCATG
TCAACTCCATTAGTTGTTGGAACTACCATTGGTGCTGCTGCTTTGGGAGCTAGATACTTGATAAGAGCGTGGCAAAGGTTCAAAGCAGCACCCCG
AGTGAGGAGGTTTTATCCTGGGGGCTTTGATCGGGATATGACACGGCGAGAAGCAGCATTGATTCTCGGAGTTAGGGAAAGTGCTGTCTTGCAGA
AGATCAAGGAGGCTCACAGGAGAGTAATGGTAGCAAATCATCCAGACGCCGGTGGCAGCCATTATCTTGCTTCCAAGATCAATGAAGCCAAGGAC
GTGTTGTTAGGGAAAACCAAGGGAGCTAATTCTGCATTTTAATTGACCAGTGTGTTCTTTACGCTGCGAATTCTTAACAGCTTCATGATAGTCAA
CATTAAAATGGATCTTTNTCTGGGGAAAAGGAGAACATATTCTGTTTCGAGTTAAGAGGTGAATTTGTATCAACAGCTGGGTGCATTACTGCCAT
AAATTTCATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T31860 [Download] [View] Facility Assigned ID: TCAFZ35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence