EST details — SGN-E299310

Search information 
Request: 299310Match: SGN-E299310
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C86433Clone name: cLET-43-B22
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E299310Length: 268 bp (927 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E299310 [] (trimmed) ACCCAACATCTTTTGCGGAATTTATTGTCAAAGACATCAAGAACGGGAGATTAGGGATGTTCTCCATGTTTGGATTCTTCGTTCAAGCTATTGTC
ACCGGCAAAGGCCCACTTGAAAATCTATTGGATCACCTTGACAACCCTGTTGCTAACAATGCATGGGTTTACGCAACTAAGTTTGTTCCTGGATC
TTAAATTTTTTTCACATATCGACTTTGTAGCTTTGTACCACTCAATCATTCATTCATAATGCAAATATTTGGCATATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E299310] SGN-U579843 Tomato 200607 Build 2 157 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111051 [Download] [View] Facility Assigned ID: TMEGP11TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0182 Quality Trim Threshold: 14.5