EST details — SGN-E30010

Search information 
Request: 30010Match: SGN-E30010
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14771Clone name: cLEC-9-A10
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14771 [cLEC-9-A10] Trace: SGN-T25048 EST: SGN-E200754 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E30010Length: 338 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E30010 [] (called/trimmed by facility)
AGAACATCCACAGAAGGAGACATACTGGGGCAATGTTAATCCTATTGGTGTCCGAAGTTGCTACGATGAGGGAAAACGAACAGCTGAAACATTGA
CAATGGATTATCACAGAGGTGCAGAAGTTGAGGTGAGAATCGCTAGGATCTTTAACACTTATGGACCTCGTATGTGTATTGATGACGGTCGCGTT
GTCAGCAACTTTGTCGCTCAGGCTTTAAGGAAAGAGCCTTTGACAGTTTATGGTGATGGGAAACAAACAAGAAGTTTCCAATTTGTTTCAGATCT
GGTTGAAGGCTTAATGCGGTTNGATGGAAGGAAGAACATGTCGGGACCCTTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T25048 [Download] [View] Facility Assigned ID: TCABH05TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence