EST details — SGN-E300344

Search information 
Request: 300344Match: SGN-E300344
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C89509Clone name: cLEW-17-J5
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191643 [TUS-63-I17] Trace: SGN-T343177 EST: SGN-E542302 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191643 [TUS-63-I17] Trace: SGN-T343180 EST: SGN-E542305 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E300344Length: 247 bp (851 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E300344 [] (trimmed) GAGTACGAGGATTAATCAGTGTGGATCGGTGTTGGGGGATTGAAGGACAGCGGCGGGGGAGTCATGGACCCTGCCGCTGTCCATGGGATATATTG
AGAAGCTATTAAAAGTTCGATTATCGAAGCCTGGCAAGTTGGTGCAGCTTTCCGAGTCTGAAATCAAGCAACTATGTGTTTCCTCTAGAGATATC
TTCCCTTAACAGCCAAATCTACTTGAACTTGAGACAACCATCAATATGGGCTGGGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E300344] SGN-U577760 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T113392 [Download] [View] Facility Assigned ID: TRDCO51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0273 Quality Trim Threshold: 14.5