Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E300518

Search information 
Request: 300518Match: SGN-E300518
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C87278Clone name: cLET-45-N20
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180047 [TUS-33-F13] Trace: SGN-T186810 EST: SGN-E374196 Direction: 3' Facility: INRA
Clone: SGN-C180047 [TUS-33-F13] Trace: SGN-T186811 EST: SGN-E374197 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E300518Length: 433 bp (964 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E300518 [] (trimmed) CTGGAGGATTCTTTCAACGAGGCCTTTGTAATGGTGGATGACCAACGGGCCAGAAGAAGTGGGCTTGCACTGCTGAAGAAAATAGCAGACTTGCC
AAGGGGAATAGTAGATCTTTCAGTTTTACCGGGATTTTGAAGTATGTACCAGTGTCCGCTTAGTTTGTGCCATACTATCATCTGAGGCATCAAAG
AAGAACAGCTATTGCCCATAAGCGGAGGAGAAAACAGTTAACAGACTAATGTTTTTTCCGCGGAGGCAGCTGCAACCACAACAGAGCGAACTAGA
GGAGAAACTGTTACATAAATCTGGTAACGATGTCATAATTTTGACTGTTGTACAAGTATGTAACAAGTGAATGAATAATAAAATGAACTATCGCT
TGTATGTTCACATTGCCTGAGGAATATATATCATTGTGTTTTAAGTTCAACAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E300518] SGN-U587616 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111690 [Download] [View] Facility Assigned ID: TMEGX82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0123 Quality Trim Threshold: 14.5