EST details — SGN-E300528

Search information 
Request: 300528Match: SGN-E300528
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C87008Clone name: cLET-45-A15
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179953 [TUS-33-B15] Trace: SGN-T186700 EST: SGN-E374086 Direction: 3' Facility: INRA
Clone: SGN-C179953 [TUS-33-B15] Trace: SGN-T186701 EST: SGN-E374087 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E300528Length: 433 bp (974 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E300528 [] (trimmed) AAATATAGAGAAAAAGACTAGTCTTTGGTGTTGTTGAAGGAAGATGTCAGGTGGTGGTTGTAGCATAGTATGGTTTAGAAGGGATCTGAGAGTGG
AAGATAACCCTGCTTTGGCTGCTGGAGTTAGAGCAGGGGCAGTTATTGCTGTGTTTATTTATGCTCCTGAAGAAGAAGGGCATTATTATCCTGGT
AGAGTTTCAAGATGGTGGCTTAAGCAGAGTTTGGCTCATCTTGATTCATCTTTGAAGAGTCTTGGAACCTCCCTTATTACAAAGAGATCTACTGA
TAGTATTTCTTCTCTTCTTGAAGTTGTTAAATCTACTGGTGCTACTCAGCTCTTCTTCAATCATTTGTATGGTTAGTACTTGTTTCCATTTTTTT
CTGCGGTTTTCTTGCTTCTTTAAATAAAAGATAGAGCACCACTGTTTTACTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E300528] SGN-U583256 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111700 [Download] [View] Facility Assigned ID: TMEGU08TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0042 Quality Trim Threshold: 12.5