EST details — SGN-E300642

Search information 
Request: 300642Match: SGN-E300642
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C87283Clone name: cLET-45-N3
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180051 [TUS-33-F17] Trace: SGN-T186812 EST: SGN-E374198 Direction: 3' Facility: INRA
Clone: SGN-C180051 [TUS-33-F17] Trace: SGN-T186813 EST: SGN-E374199 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E300642Length: 232 bp (897 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E300642 [] (trimmed) TGGTGGTCATGGCGCTGCTCTTCATGCCGTCTAGAAGGGTTTGAAAACTGCTATCATTGAAGGGGACGTCGTTGGAGGTACATGTGTAAATAGGG
GTGGTGTTCCTTCCAAAGCCCTTCTAGCTGTGAGTGGTCGCATGCTGGAGCTTCAGAATGAACATCATATGAAGTCTTTTGGTCTACAAGATGGT
GCCGCAGAATATGACAGACAGGGTGTTGCTGATCATGCAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E300642] SGN-U595519 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111814 [Download] [View] Facility Assigned ID: TMEGW74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0369 Quality Trim Threshold: 14.5