EST details — SGN-E300657

Search information 
Request: 300657Match: SGN-E300657
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C87065Clone name: cLET-45-D14
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179971 [TUS-33-C9] Trace: SGN-T186372 EST: SGN-E373920 Direction: 3' Facility: INRA
Clone: SGN-C179971 [TUS-33-C9] Trace: SGN-T186373 EST: SGN-E373921 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E300657Length: 598 bp (907 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E300657 [] (trimmed) CACGTTACTCAACTTTGACTTCTGGCGTGCGTTCGGCGGAAGTTCAGAGATCGGTGAAGATGACCAAACTTCATGCTTTTAACGACTTGTTGGAG
CACAACAACAAAGATGATTGCTGGCTTCTCATCTCTGGAAAGGTTTATGATGTAACCTCTTTTTTGGATGATCATCCTGGAGGTGATGAAGTGTT
GCTAACTGCAACAGGCAAGGATGCGACAGATGATTTTGAAGATGTCGGTCACAGTGATGATGCACGAGAGATGTTGAAGAAATACTTCATTGGTG
AAATAGACAGTTCCACCATTCCTGCAGAACGCAAACATACCCCGCCTCCCTCAGCAACACCATCAGCTGGAGGACAGGGTTCTGGAAACTCATGG
AAGCTATTGCAATTCTTGTTACCCTTGTTGATATTGGGTGCAGCCCTTGCCTTCCGTTCCTTTTACCAGAAAGAATAGATCAGCCAGTTGTCATG
TTTCAAGCTGTGACTGGATACCCTTGCAGCATGTCATTTCATATGTTGCGCTGTCCTATTCAGGATATGTCTATTTGCTACCTGTGTTGGATGTC
CTTTACTGGTATAATGAGATATTAAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E300657] SGN-U563020 Tomato 200607 Build 2 41 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T111829 [Download] [View] Facility Assigned ID: TMEGX19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0150 Quality Trim Threshold: 12.5