EST details — SGN-E300963

Search information 
Request: 300963Match: SGN-E300963
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C91818Clone name: cLEW-8-J19
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEW-8-J19.
Additional sequencing 
Clone: SGN-C191443 [TUS-63-A9] Trace: SGN-T342834 EST: SGN-E541959 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191443 [TUS-63-A9] Trace: SGN-T342836 EST: SGN-E541961 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E300963Length: 538 bp (897 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E300963 [] (trimmed) GGAAAGGTGGAGCTGGTGTTGTGTACCGAGGGTCTATGTCAAATGGCATCGACGTTGCAATAAAGAAACTTGTAGGCCGAGGAACCGGACACCAT
GATCACGGATTCTCAGCTGAAATCCAAACACTAGGAAGGATCCGGCACAGAAACATCGTACGATTACTGGGATATGTCTCAAACAAAGACACAAA
CTTGTTGTTGTACGAATACATGTCAAATGGGAGCTTAGGTGAAATGTTACATGGTGCCAAAGGGGCACATTTGAAATGGGAGACAAGGTACCGTA
TTGCTGTGGAAGCTGCAAAAGGATTGTGTTATTTGCACCATGATTGTTCACCTTCGATTATTCACAGAGATGTCAAGTCCAATAATATTCTGCTG
GATTCCGATTACGAAGCGCATGTTGCTGATTTCGGCCTCGCCAAATTCTTGCAGGATGCTGGTGCATCAGAGTGCATGTCCTCTATTGCTGGCTC
ATATGGTTACATTGCTCCAGAGTATGCATACACATTGAAAGTTGACCAAAAGAGTGATGTATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E300963] SGN-U576274 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T112568 [Download] [View] Facility Assigned ID: TRDBE58TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0102 Quality Trim Threshold: 14.5