EST details — SGN-E301209

Search information 
Request: 301209Match: SGN-E301209
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C90443Clone name: cLEW-22-J12
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C191805 [TUS-63-P11] Trace: SGN-T343458 EST: SGN-E542583 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C191805 [TUS-63-P11] Trace: SGN-T349612 EST: SGN-E548737 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E301209Length: 168 bp (1052 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E301209 [] (trimmed) CGAGAGTTCAAAAAAGGACATTGGGTGGACTTCCACGTAAAATAAAAATCTTCACAACATGGGAACATTTGGACTCAATAATCGGTCTTGCATTT
ATATGAAGTTACCCACTTATTGAAGCAACAAAAAACATCAATTATTCATCCCATGCCAGAAAATCTACACTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E301209] SGN-U564259 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T114107 [Download] [View] Facility Assigned ID: TRDDJ54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.887 Expected Error Rate: 0.0245 Quality Trim Threshold: 12.5