EST details — SGN-E301430

Search information 
Request: 301430Match: SGN-E301430
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C95119Clone name: cLEX-8-K2
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192301 [TUS-65-E3] Trace: SGN-T344314 EST: SGN-E543439 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C192301 [TUS-65-E3] Trace: SGN-T349753 EST: SGN-E548878 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E301430Length: 336 bp (735 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E301430 [] (trimmed) CCGAGGGTCATCCAAAAAGTTGTTGATCTTGTTTATTCTTGTACACAACATGTACCATCAATGCGGCCTCTGGTGATACACGGAACATCATAATC
TACAACAATTAGCTCAGCCTCCTATTGTAAAGTAAGTGGATAAGAGTTATAGATCAGCATTTCTTTTGACTGAAACCAGCCTGCAATCTTTTATC
CTAGTTACAAGGGCTAACTGTATTAGGCATTTATTTTTTAAAACTTGCCAATGACATGCAAGGCCTTGAGCCTTGAACCAGTCCATGATGGTTTG
AGATGTTATACAACAACTAATTTGTATTACCAAAGCCAGTATGTTTTCATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E301430] SGN-U594400 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T115957 [Download] [View] Facility Assigned ID: TRXBD61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0172 Quality Trim Threshold: 12.5