EST details — SGN-E302453

Search information 
Request: 302453Match: SGN-E302453
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C91359Clone name: cLEW-27-B2
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E302453Length: 452 bp (920 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E302453 [] (trimmed) AAAATCTGCATTTTTTCTCCATAACAACGCTCCAAATGACCAGCAGAAAGATTGTGCGGGACTTGTTTATCTCCAAACAACCTGTTTTCCGCCGA
ATATTAGCACCGCAACAGGTGGTTTTACATTGATGTTCATCTCCTTTGAGGTTTGTTGGAGCAGATAGGTATCTGGGTATTCGTCATTTCGGTGT
ATTCAATGAGTTCTCCAAGAAAGTTAAAGGCGAAGTAGACAGTAATCAAGAATTCCAACAGTCTGTCAAGGTGTTGAAGGAGAAAGCAGAGGAGT
TAAAAGGGGTGAAAGAAGATCTTAAAACAAGAACGAAGCAGACAACTGAGCAGCTTTACAAGCATGTCGATGGTGTTTGGACGGAAGCTGAAGCT
ACGGCAAAAAAAGTTTATGCCAATGTGGAGGAAAAAATATCTGCTACTAAAGAGGAGGTCAGGTCAAGCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E302453] SGN-U564221 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T115036 [Download] [View] Facility Assigned ID: TRDED01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0128 Quality Trim Threshold: 20.5