EST details — SGN-E303078

Search information 
Request: 303078Match: SGN-E303078
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C91333Clone name: cLEW-26-P1
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192018 [TUS-64-I8] Trace: SGN-T343827 EST: SGN-E542952 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192018 [TUS-64-I8] Trace: SGN-T343828 EST: SGN-E542953 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E303078Length: 446 bp (648 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E303078 [] (trimmed) GTTATGACTCATTGGGATGGATTATTGACTAAACCAGGCGAGCGTATTCTTGTTCTTGCTGCAACCAACAGACCTTTCGACCTCGATGAAGCAAT
AATCAGACGGTTTGAGCGCAGAATTATGGTCGGTTTACCTGCAGCTGAGAATAGAGAGAAGATTTTGAGAACTCTTCTAGCAAAGGAAAAGGTAG
AAGATCTTGACTTTAAAGAGCTCGGAGTCATGACCGAAGGATATAGTGGAAGTGATCTTAAGAACTTGTGCACAACAGCAGCTTACCGGCCTGTC
AGAGAGCTTATACAACAAGAGAGAAAGAAAGATTTGGAAAAGAAACGGAGAACTGAAGAAGAGCAGAGTGCAGAAGGTAATTCAGATAAGAAAGA
AGAAGCCTCGGAAGAAAGAGTAATTACTTTGAGGCCTCTAAACATGGAGGACATGAGACAGGCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E303078] SGN-U566431 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T114910 [Download] [View] Facility Assigned ID: TRDDY85TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0003 Quality Trim Threshold: 14.5