EST details — SGN-E303282

Search information 
Request: 303282Match: SGN-E303282
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C94800Clone name: cLEX-5-L10
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192228 [TUS-65-B2] Trace: SGN-T344188 EST: SGN-E543313 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192228 [TUS-65-B2] Trace: SGN-T344189 EST: SGN-E543314 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E303282Length: 586 bp (870 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E303282 [] (trimmed) GCTGGATTTGGGTTGGCAGCTGGAGATGAGAGCAATGGGCCCTGATGCTACTTCTTATCATCCAGGACTTTACTTAACCCAAGCTCAGACAGAAG
CAGTGGAAGCACTCATTCAGGAACTGCCAAAGTTCTGCCTGAAGGCTGTTCCTACTGACTGTAGCGAGTGCCCTATCTGTTTGGAAGAGTTTCGC
ATGGGAAATGAGGTTCGTGGTCTGCCTTGTGCTCACAACTTTCACGTGGAATGCATTGATGAATGGCTTCGCCTAAACGTGAAATGCCCTAGATG
CCGCTCTTCTGTCTTTCCAAATCTTGATCTCAGTGCTTTATCCAATATCCGAACCGATTCAGAGGGGTCAACAGCCAATGTTGTGACAGCAGCAC
AGTATGTGAGATCCCAACCCTCCAGCCAGAGCTATCTGCTAAGAATGCAAGGTTTGCTCCGCCCTGTACGCACACAAGATGCTGGCCTGGGCAGT
GAGGTACATCCAGCTGATAGCAGCAACCAAGCATGCACACCTCATAGTCACGGATTCGTGGAACCAGTACAAGTTATAGTGGAACAGTCCCCAAG
GGAGCTATAACCATAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E303282] SGN-U580880 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T116479 [Download] [View] Facility Assigned ID: TRXAT65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.988 Expected Error Rate: 0.0145 Quality Trim Threshold: 14.5