EST details — SGN-E304131

Search information 
Request: 304131Match: SGN-E304131
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C94861Clone name: cLEX-6-A1
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C94861 [cLEX-6-A1] Trace: SGN-T116009 EST: SGN-E303991 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E304131Length: 448 bp (787 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E304131 [] (trimmed) GATAATCCCACTGAACCATTTCACTAGACATTAAAATATGAAATACATCAACAGTTGGTAGCAGTATAGAGATTGTTTTACACACATACCTTAAC
TCAGTAATAACCTACATACACCATATTTTTGCTTAGAGTTACAACTTTGGACACACTGTAAGTACACCAATAAACAAGGTTCAGGGGAATTTGTT
AAACGTACACTAAAGTGGCGCTTCTTCTGAAGCTATTCATCAAGCTTCTAAAAACAGTTGGTGTCGTAGGTAGCGAGTCCCAACAACTCCGGACC
TTCAAGTCGAGGATTGTGCTCGAAATTGTTTAGAGGAATATGCTCAAATGGACCAGAAGTAGGAATTGTTCCACACAAATCATTATTCGAGACAT
CCACAACTTTCAGGCTAGAAATGCTAGTAAGTTCTGTTGGGATTGGACCTGTTAGCTTGTTATCATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E304131] SGN-U583216 Tomato 200607 Build 2 165 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T116149 [Download] [View] Facility Assigned ID: TRXAU01TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0190 Quality Trim Threshold: 14.5