EST details — SGN-E304134

Search information 
Request: 304134Match: SGN-E304134
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C94863Clone name: cLEX-6-A13
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C94863 [cLEX-6-A13] Trace: SGN-T116014 EST: SGN-E303996 Direction: 3' Facility: TIGR
Clone: SGN-C192247 [TUS-65-B21] Trace: SGN-T344221 EST: SGN-E543346 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192247 [TUS-65-B21] Trace: SGN-T349738 EST: SGN-E548863 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E304134Length: 355 bp (908 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E304134 [] (trimmed) TTTTTCTTGACAGACTGCCGACGGGAAGCTGTGTTCAAAACCCAGAGTTTGTTCTTGAAGTTATGGGGGTTGTTGGCAGTTGGTTTCGTTACACC
CAATGACAGAGAAGAGCTGACAATCTTTTTTTTTTTTCTCTCTCACACAAATCATCATTATATAAAGAAGACTTTGGACTCTGTTACAAGTCCGA
AAATATCAGATGTTCATTCTCTAACCTCAAATCGAACCTTTTTTTTCTTTAATTTTTGGGTTTTTTTGTTGTGATTTGGATCAATGTCGAAGAAT
ATATTGGTGACGGGTGGAGCTGGGTATATTGGGAGTCACACGGTGTTACAGTTGCTGTTGGGTGGTTATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E304134] SGN-U589830 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T116152 [Download] [View] Facility Assigned ID: TRXAU07THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.921 Expected Error Rate: 0.0202 Quality Trim Threshold: 14.5