Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E304811

Search information 
Request: 304811Match: SGN-E304811
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C92131Clone name: cLEX-10-D17
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192330 [TUS-65-F8] Trace: SGN-T344363 EST: SGN-E543488 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192330 [TUS-65-F8] Trace: SGN-T344364 EST: SGN-E543489 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E304811Length: 558 bp (847 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E304811 [] (trimmed) TTGGACAGGAAGACACTGAAGTTTTCTTATAGAAAATATGGGTTGAAAATATGAAGCTTCAAAATAGACTTCTATGAAGATCTAAAGCCAACCAC
TTGTTGGAATCAAGTGAAAAGCCAAGTCACAAAGCATTAGTAGAATATGGGTGTTTGAAGCTTCTTTGATAAAATTCCAATACATCTTAGAAAAT
CATTTTTGAATCCTTACAAGAGCTTTTGATCTTCCTTTACAAACCAAACTTAAAAACATTTCAAAAAAACCATTCCATGGCTATGTTGGACAATA
TCCTCAAGTTCCACTCTATGAAAGTATGGGCATTGATGATGCTAATATTCCTCATAAAGCTGAAAAATTCACTCAAATTCTGTGGCCTCAAGGAA
ATCCTACTTTTTGCAAGACTATTCAGTCATACTCAGAGCAACTATCAGAATTAGATCAAACAATAAGGAGAATGATTGTGGAGAGTTTAGGGGTC
GAAAAATACATGGATGAACATATGAATTCAACTAGTTACCTTCTTCGAGTGATGAAGTATAAAGGACCCCAAAGCAGTGAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E304811] SGN-U575221 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T116585 [Download] [View] Facility Assigned ID: TRXBM21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0149 Quality Trim Threshold: 20.5