EST details — SGN-E305411

Search information 
Request: 305411Match: SGN-E305411
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93841Clone name: cLEX-15-O21
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192630 [TUS-66-B20] Trace: SGN-T344879 EST: SGN-E544004 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192630 [TUS-66-B20] Trace: SGN-T349846 EST: SGN-E548971 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305411Length: 243 bp (889 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E305411 [] (trimmed) GGTTCTCCAAAAATGGCTCAGATGAAAGTTGTAATGAAGGTGCTAACCATGTCTGATGAAAAAACAAAGCAGAAAGCCATAGAAGCTGCAGCTGA
TATTTTAGGTGTAGATTCAATAGCAGCAGATCTAAAGGAGCAAAAATTGACAGTTATAGGGGAAATGGATGCAGTTGCAGTGGTGAAGAAATTGA
AAAAAGCTGTTGGTAAAGTAGATATATTATCAGTGGGACCAGCTAAGGAAGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305411] SGN-U566513 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T117897 [Download] [View] Facility Assigned ID: TRXCE95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.882 Expected Error Rate: 0.0068 Quality Trim Threshold: 12.5