EST details — SGN-E305758

Search information 
Request: 305758Match: SGN-E305758
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93339Clone name: cLEX-14-G24
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180101 [TUS-33-H19] Trace: SGN-T186738 EST: SGN-E374124 Direction: 3' Facility: INRA
Clone: SGN-C180101 [TUS-33-H19] Trace: SGN-T186739 EST: SGN-E374125 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305758Length: 578 bp (865 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E305758 [] (trimmed) GCCTTTGTGGTATCAACGCTCCTCATTTCTCAACTCCTCAGCTAAATAATCAAACAAATATACGTTTGAATTTGGAGAAATCCGGTTGTGGAATC
GGAAGCAATAGAGGATGGGTTCGGCGATGAAAGCAATCTACACCGTTGGATTCTGGATCCGTGAGACAGGCCAAGCCCTTGATCGGTTGGGCTGC
CGCCTCCAGGGAAACTATTACTTCCAAGAACACCTCTCGAGGCATAGAACTTTGATGAACCTGTTTGACAAAATACCAATTGTTGAGAAAGATGC
ATTTGTGGCCCCAAGAGCCTCTATAATTGGTGATGTTCACATTGGGCGTAGGGCTTCTATTTGGTATGGGTGTGTTCTGCGAGGTGATGTGAACA
GTGTCAGCATTGGAGCCGGAACTAATGTCCAGGACAATTCTCTAATCCATGTAGCTAAATCGAATATCAGTGGAAAGGTTTTGCCTACGATAATT
GGCCAAAATGTTACCATAGGTCATAACGCTGGGTTACATGGATGTACTGTTGAAGACGAGGCATTTATTGGTATGGGTGCAACCGCGCTTGATGG
AGCTGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305758] SGN-U566773 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T118244 [Download] [View] Facility Assigned ID: TRXCB48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0161 Quality Trim Threshold: 14.5