EST details — SGN-E305998

Search information 
Request: 305998Match: SGN-E305998
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C96814Clone name: cLEY-17-P1
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193018 [TUS-67-B24] Trace: SGN-T345545 EST: SGN-E544670 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193018 [TUS-67-B24] Trace: SGN-T345546 EST: SGN-E544671 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305998Length: 528 bp (934 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E305998 [] (trimmed) GATTACTTAATAACTCCAATTCTTCTTTCTCTCGTTTTTGTGGTCACTTTGAGATATTTCTATCGATCAAAAACAAAATTACCGCTTCCTCCAGG
TCCATTTTCATGGCCCTTTATTGGAAATCTTTTCCATGTTGGTAGAAAACGTCCTCATGCTTCTCTAGCAAAGCTAGCTCAATCTCATGCTCCTG
ATTTAATGTCCTTAAGGTTCGGTACACGTCTCGTGGTCGTAGCCTCATCCCCTGCAGCTGCTGCTGCGGTTCTTAAAACACATGATCGTTTGCTT
TCTGGTCGTTTCGTTTCTCATCCCATACGAGTTGAGGGATCGAAACTTCATAATGTGTCAACTGCTTTTTTAGAAGAGTGTGATGAGAATTGGAA
AAACGTTCGAACTATATACAGGGGAGCCCTGTTTTCTAACAAAGCATTGGAATCACAAGTGAGTTTAAGGGAGAACAAAATCAGGGAAATGATGC
AATATTTAGATACTAAAATGGGACAAGTGATTAAAATAAAGTTTGTGGTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305998] SGN-U575463 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T120282 [Download] [View] Facility Assigned ID: TRYCO85TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0061 Quality Trim Threshold: 14.5