EST details — SGN-E306071

Search information 
Request: 306071Match: SGN-E306071
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C95915Clone name: cLEY-13-M9
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192839 [TUS-66-K13] Trace: SGN-T345238 EST: SGN-E544363 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C192839 [TUS-66-K13] Trace: SGN-T349905 EST: SGN-E549030 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E306071Length: 308 bp (860 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E306071 [] (trimmed) GAGCGGCGCCACCGGGACATGTACTCTCTTACTTTCGATACACAGCCACGTGCCCGTTTCATGTGCAGCTTCGGTGGCAAAATTGTGCTCATGCC
ACACGACAGGTCAACTTCGTTACGTCGGCGGCGATACTCGAATTGTTGCGGTGAACCGCCACACTACCTTCGCAGCTCTCCTTGGAAAACTCTCC
AAACTCATCGGATATCCAAACATTAACATCAAGTACCAGCTTCCTAACGAGGAACTGGATGCTTTGATAACCGTCACAACCGATGAAGATTTGGA
GAATATGATGGAAGAGTACGATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E306071] SGN-U585430 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T119249 [Download] [View] Facility Assigned ID: TRYBW77TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0254 Quality Trim Threshold: 14.5